Review



qpcr primer synthesis  (Sangon Biotech)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Sangon Biotech qpcr primer synthesis
    Qpcr Primer Synthesis, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+primer+synthesis/primer+synthesis/pm42153663-354-24-28
    Average 86 stars, based on 1 article reviews
    qpcr primer synthesis - by Bioz Stars, 2026-09
    86/100 stars

    Images

    Related Articles

    Real-time Polymerase Chain Reaction:

    Article Title: Immunogenicity and Protective Efficacy of Toxoplasma gondii SRS67 and SRS20A Proteins in mice
    Article Snippet: Nuclei were stained with DAPI (Beyotime, Shanghai, China) for 5 min, mounted with antifade medium, and protein localization was examined using fluorescence microscopy (Olympus, Tokyo, Japan). .. The sequences of GAPDH , SRS67 and SRS20A were downloaded and sent to Sangon Biotech (Shanghai) for qPCR primer synthesis: GAPDH , F: 5’-TGGTGTTCCGTGCTGCGATGGAAC-3’, R: 5’-GAGCTTGCCGTCCTTGTGGCTGAC-3’; SRS67 , F: 5’-GGGCGACGGCGACAATTCC-3’, R: 5’-GCATTCCCTCCAGTCCAGAACAG-3’; SRS20A , F: 5’-AACGCACAGATGAAAGGGGAAGC-3’, R: 5’-GTCCATGCTCCGCTCGTGATTC-3’. .. Using cDNA from T. gondii RH and PRU strains, qPCR was performed in 50 μL containing 25 μL 2× FastSYBR Mixture (Cwbio, Jiangsu, China), 1 μL each primer, 2 μL cDNA, and ddH2O to 50 μL.

    Article Title: mechanical stress-mediated ferritinophagy aggravates cartilage endplate degeneration via Piezo1-NCOA4-ZBP1 axis.
    Article Snippet: Abnormal mechanical stress is closely linked to intervertebral disc degeneration (IVDD).. Iron homeostasis disorder occurs in various degenerative diseases, including IVDD.. PIEZO1 serves as a mechanosensitive cation channel, involving in multiple physiological and pathological processes; however, its potential association with iron homeostasis and IVDD remain to be elucidated.

    Bioprocessing:

    Article Title: mechanical stress-mediated ferritinophagy aggravates cartilage endplate degeneration via Piezo1-NCOA4-ZBP1 axis.
    Article Snippet: Abnormal mechanical stress is closely linked to intervertebral disc degeneration (IVDD).. Iron homeostasis disorder occurs in various degenerative diseases, including IVDD.. PIEZO1 serves as a mechanosensitive cation channel, involving in multiple physiological and pathological processes; however, its potential association with iron homeostasis and IVDD remain to be elucidated.

    Sequencing:

    Article Title: mechanical stress-mediated ferritinophagy aggravates cartilage endplate degeneration via Piezo1-NCOA4-ZBP1 axis.
    Article Snippet: Abnormal mechanical stress is closely linked to intervertebral disc degeneration (IVDD).. Iron homeostasis disorder occurs in various degenerative diseases, including IVDD.. PIEZO1 serves as a mechanosensitive cation channel, involving in multiple physiological and pathological processes; however, its potential association with iron homeostasis and IVDD remain to be elucidated.



    Similar Products

    maxima first strand cdna synthesis kit for rt-qpcr with dsdnase and random primers #k1671  (Thermo Fisher)
    90
    Thermo Fisher maxima first strand cdna synthesis kit for rt-qpcr with dsdnase and random primers #k1671
    Maxima First Strand Cdna Synthesis Kit For Rt Qpcr With Dsdnase And Random Primers #K1671, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+primer+synthesis/revertaid+first+strand+cdna+synthesis+kit/pm38652230-111-23-28
    Average 90 stars, based on 1 article reviews
    maxima first strand cdna synthesis kit for rt-qpcr with dsdnase and random primers #k1671 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    qpcr primer synthesis  (Sangon Biotech)
    86
    Sangon Biotech qpcr primer synthesis
    Qpcr Primer Synthesis, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+primer+synthesis/primer+synthesis/pm42153663-354-24-28
    Average 86 stars, based on 1 article reviews
    qpcr primer synthesis - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    fluorescence quantitative polymerase chain reaction (qpcr) primer synthesis  (Thermo Fisher)
    90
    Thermo Fisher fluorescence quantitative polymerase chain reaction (qpcr) primer synthesis
    Fluorescence Quantitative Polymerase Chain Reaction (Qpcr) Primer Synthesis, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+primer+synthesis/pm38072544-45-50-58
    Average 90 stars, based on 1 article reviews
    fluorescence quantitative polymerase chain reaction (qpcr) primer synthesis - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    sybr green and quantitative pcr (qpcr) primer synthesis thermo fisher  (Thermo Fisher)
    90
    Thermo Fisher sybr green and quantitative pcr (qpcr) primer synthesis thermo fisher
    Sybr Green And Quantitative Pcr (Qpcr) Primer Synthesis Thermo Fisher, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+primer+synthesis/powerup+sybr+green+master+mix/pm37945263-39-13-21
    Average 90 stars, based on 1 article reviews
    sybr green and quantitative pcr (qpcr) primer synthesis thermo fisher - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    oligo(dt) primers hifair® iii 1st strand cdna synthesis supermix for qpcr  (Yeasen Biotechnology)
    90
    Yeasen Biotechnology oligo(dt) primers hifair® iii 1st strand cdna synthesis supermix for qpcr
    Oligo(dt) Primers Hifair® Iii 1st Strand Cdna Synthesis Supermix For Qpcr, supplied by Yeasen Biotechnology, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+primer+synthesis/hifair++ii+1st+strand+cdna+synthesis+kit/pm37499811-104-5-18
    Average 90 stars, based on 1 article reviews
    oligo(dt) primers hifair® iii 1st strand cdna synthesis supermix for qpcr - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    universal qpcr primer (oligo from ncodetm mirna first-strand cdna synthesis and qrt-pcr kits)  (Thermo Fisher)
    90
    Thermo Fisher universal qpcr primer (oligo from ncodetm mirna first-strand cdna synthesis and qrt-pcr kits)
    A) drd1 , B) drd2a , C) drd2b and D) drd3 gene expression levels were measured at 8, 16, 24, 48 and 72 hpf using <t>qPCR.</t> All results were normalized to ef1α expression and β-actin ( , respectively). Two hundred and fifty embryos were used to extract RNA and <t>synthesize</t> <t>cDNA.</t> Error bars represent means of mRNA copies at each developmental stage ± SEM. Three independent experiments (each performed three times) were conducted for each stage. P values were calculated by two-way ANOVA, with the Bonferroni post-hoc test: * P <0.05, ** P <0.01 and *** P <0.001.
    Universal Qpcr Primer (Oligo From Ncodetm Mirna First Strand Cdna Synthesis And Qrt Pcr Kits), supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+primer+synthesis/pmc03528707-218-89-103
    Average 90 stars, based on 1 article reviews
    universal qpcr primer (oligo from ncodetm mirna first-strand cdna synthesis and qrt-pcr kits) - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    ncode mirna firststrand cdna synthesis qpcr universal primer  (Thermo Fisher)
    90
    Thermo Fisher ncode mirna firststrand cdna synthesis qpcr universal primer
    A) drd1 , B) drd2a , C) drd2b and D) drd3 gene expression levels were measured at 8, 16, 24, 48 and 72 hpf using <t>qPCR.</t> All results were normalized to ef1α expression and β-actin ( , respectively). Two hundred and fifty embryos were used to extract RNA and <t>synthesize</t> <t>cDNA.</t> Error bars represent means of mRNA copies at each developmental stage ± SEM. Three independent experiments (each performed three times) were conducted for each stage. P values were calculated by two-way ANOVA, with the Bonferroni post-hoc test: * P <0.05, ** P <0.01 and *** P <0.001.
    Ncode Mirna Firststrand Cdna Synthesis Qpcr Universal Primer, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+primer+synthesis/ncode+mirna+firststrand+cdna+synthesis+qpcr+universal+primer/pm36047706-226-14-32
    Average 90 stars, based on 1 article reviews
    ncode mirna firststrand cdna synthesis qpcr universal primer - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    specific qpcr primers were designed for the nr1h3 gene and 13 genes related to milk fat synthesis  (Premier Biosoft)
    90
    Premier Biosoft specific qpcr primers were designed for the nr1h3 gene and 13 genes related to milk fat synthesis
    A) drd1 , B) drd2a , C) drd2b and D) drd3 gene expression levels were measured at 8, 16, 24, 48 and 72 hpf using <t>qPCR.</t> All results were normalized to ef1α expression and β-actin ( , respectively). Two hundred and fifty embryos were used to extract RNA and <t>synthesize</t> <t>cDNA.</t> Error bars represent means of mRNA copies at each developmental stage ± SEM. Three independent experiments (each performed three times) were conducted for each stage. P values were calculated by two-way ANOVA, with the Bonferroni post-hoc test: * P <0.05, ** P <0.01 and *** P <0.001.
    Specific Qpcr Primers Were Designed For The Nr1h3 Gene And 13 Genes Related To Milk Fat Synthesis, supplied by Premier Biosoft, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qpcr+primer+synthesis/specific+qpcr+primers+were+designed+for+the+nr1h3+gene+and+13+genes+related+to+milk+fat+synthesis/pm34593221-66-1-22
    Average 90 stars, based on 1 article reviews
    specific qpcr primers were designed for the nr1h3 gene and 13 genes related to milk fat synthesis - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results


    A) drd1 , B) drd2a , C) drd2b and D) drd3 gene expression levels were measured at 8, 16, 24, 48 and 72 hpf using qPCR. All results were normalized to ef1α expression and β-actin ( , respectively). Two hundred and fifty embryos were used to extract RNA and synthesize cDNA. Error bars represent means of mRNA copies at each developmental stage ± SEM. Three independent experiments (each performed three times) were conducted for each stage. P values were calculated by two-way ANOVA, with the Bonferroni post-hoc test: * P <0.05, ** P <0.01 and *** P <0.001.

    Journal: PLoS ONE

    Article Title: Modulation by Cocaine of Dopamine Receptors through miRNA-133b in Zebrafish Embryos

    doi: 10.1371/journal.pone.0052701

    Figure Lengend Snippet: A) drd1 , B) drd2a , C) drd2b and D) drd3 gene expression levels were measured at 8, 16, 24, 48 and 72 hpf using qPCR. All results were normalized to ef1α expression and β-actin ( , respectively). Two hundred and fifty embryos were used to extract RNA and synthesize cDNA. Error bars represent means of mRNA copies at each developmental stage ± SEM. Three independent experiments (each performed three times) were conducted for each stage. P values were calculated by two-way ANOVA, with the Bonferroni post-hoc test: * P <0.05, ** P <0.01 and *** P <0.001.

    Article Snippet: The oligonucleotides used to amplify the genes studied in this work were as follows: ef1α : forward, GTACTTCTCAGGCTGACTGTG ; reverse, ACGATCAGCTGTTTCACTCC . β-actin: forward, ACCACGGCCGAAAGAGAA ; reverse, ATACCCAGGAAGGAAGGCTG . drd1 : forward, ACGCTGTCCATCCTTATCTC ; reverse, TGTCCGATTAAGGCTGGAG . drd2a : forward, TGGTACTCCGGAAAAGACG ; reverse, ATCGGGATGGGTGCATTTC . drd2b : forward, AAATAACACAGCTACACGGGAT ; reverse, GAACCACGTAAATCTGCACG . drd3 : forward, ATCAGTATCGACAGGTATACAGC ; reverse, CCAAACAGTAGAGGGCAGG . pitx3 : forward, GACAACAGTGACACAGAGAAGT ; reverse, GAGAAACCGTTATCCCGACA . th : forward, TTTGAAGAGAAGTGCAGAGGAT ; reverse, GGATCACCCAGGATTTACTGA . dat : AGACATCTGGGAAGGTGGTG ; reverse, ACCTGAGCATCATACAGGCG . dre-miR-133b : forward, TTTGGTCCCCTTCAACCAGCTA ; reverse Universal qPCR Primer (oligo from NCodeTM miRNA First-Strand cDNA Synthesis and qRT-PCR Kits) (Invitrogen).

    Techniques: Expressing

    Expression of miR-133b, pitx3 and its targets genes ( th, dat, drd2a and drd2b ) at 24 and 48 hpf in whole-mount embryos (A–F), in the head (G–L) and at the periphery (M–R). Total RNA was isolated from two hundred and fifty embryos and used to synthesize cDNA. Gene expression levels were measured at 24 and 48 hpf by qPCR and were normalized to ef1α expression. Error bars represent means of mRNA copies at each developmental stage ± SEM. Data are representative of three independent experiments and each experiment was performed three times. P values were calculated using two-way ANOVA followed by Bonferroni's post-hoc comparisons tests: * P <0.05, ** P <0.01 and *** P <0.001.

    Journal: PLoS ONE

    Article Title: Modulation by Cocaine of Dopamine Receptors through miRNA-133b in Zebrafish Embryos

    doi: 10.1371/journal.pone.0052701

    Figure Lengend Snippet: Expression of miR-133b, pitx3 and its targets genes ( th, dat, drd2a and drd2b ) at 24 and 48 hpf in whole-mount embryos (A–F), in the head (G–L) and at the periphery (M–R). Total RNA was isolated from two hundred and fifty embryos and used to synthesize cDNA. Gene expression levels were measured at 24 and 48 hpf by qPCR and were normalized to ef1α expression. Error bars represent means of mRNA copies at each developmental stage ± SEM. Data are representative of three independent experiments and each experiment was performed three times. P values were calculated using two-way ANOVA followed by Bonferroni's post-hoc comparisons tests: * P <0.05, ** P <0.01 and *** P <0.001.

    Article Snippet: The oligonucleotides used to amplify the genes studied in this work were as follows: ef1α : forward, GTACTTCTCAGGCTGACTGTG ; reverse, ACGATCAGCTGTTTCACTCC . β-actin: forward, ACCACGGCCGAAAGAGAA ; reverse, ATACCCAGGAAGGAAGGCTG . drd1 : forward, ACGCTGTCCATCCTTATCTC ; reverse, TGTCCGATTAAGGCTGGAG . drd2a : forward, TGGTACTCCGGAAAAGACG ; reverse, ATCGGGATGGGTGCATTTC . drd2b : forward, AAATAACACAGCTACACGGGAT ; reverse, GAACCACGTAAATCTGCACG . drd3 : forward, ATCAGTATCGACAGGTATACAGC ; reverse, CCAAACAGTAGAGGGCAGG . pitx3 : forward, GACAACAGTGACACAGAGAAGT ; reverse, GAGAAACCGTTATCCCGACA . th : forward, TTTGAAGAGAAGTGCAGAGGAT ; reverse, GGATCACCCAGGATTTACTGA . dat : AGACATCTGGGAAGGTGGTG ; reverse, ACCTGAGCATCATACAGGCG . dre-miR-133b : forward, TTTGGTCCCCTTCAACCAGCTA ; reverse Universal qPCR Primer (oligo from NCodeTM miRNA First-Strand cDNA Synthesis and qRT-PCR Kits) (Invitrogen).

    Techniques: Expressing, Isolation